Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14267F7
Clone ID IST14267F7
Vector VICTR74
Project tigm

Sequence tag IST14267F7BBF1
Sequence
ACCGGACTCCAGANAGTGGAGAACCATTTGTCCTCACAGGCCTGCCCCTGACAGGGCTGCAGGGCAGGCGGCCTGGGTAG
GTGGGAACAGTTGCTGGGAGAAGTCACATTGAACTCGGCCCCCAGCTTGGACACACAGATAATGTCTCTGTGTTGTGTGC
CAGACCCACACTCCGAGGAACACTGTAAGGGAGGGGAAGAGAGATCACTCTTAAGTTTAAAATGTGGGGCTTCGCCAGGA
CTGGTTTCCCTTCGGTCCCGCATCTCAGGGCCCCCAGCTGACCTCACTCCANGGGCCTGTGAACCANCGCCATGTCCTCT
CACAGGGCCNTAAACTGCAGGCACGCATATCNNGAGGNCGGCTTCTGANANGGCNNCNNNGCTCAGTGCTTCCTGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 95481449..95481843 367
 
EST/CDNA Est Name
  BG242515.1


Sequence tag IST14267F7HMF2
Sequence
NAAGTGGAGGCATCTGGGTTGTTTCTTTGANACTAATCANAAAGACAGATGCTATGAACCATTANTTATGGGTTTTTANG
TGGACACTAGTTCTTATTTTCTGGAAGAGATGTGAACAACCTTGAGAAACTTCTGTGTTCTCCACTATTAAAACATGACC
CTGCTGTTCTGTATCAGATGGCAGAGTTTTGACTCCTCTGATAGCCCGAGGTTGGGTGAGTCAGGAAATACTTGTTGGGG
TAAGACATGGGACACTCCCCTTTAAGCCAGGCATTCTGGGTGCAGAAACAGGCCGATCCTCCAGAAATCCAGGCCNGCTC
AGTCTACATATGGATTTCCAGGTTAGCCANGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 48238502..48238849 338
 
EST/CDNA Est Name
  BY556275.1


Sequence tag IST14267F7HMR1
Sequence
NGTGANTGNNNGNNNNNNNNNCNNNGNNNGNNNNNNNCNNCNNGNNANAGGCCTGCACTCAGCCNAGCCTCTCTCGGCCC
AGGACAACCCAGTCC
Sequence Type genomic DNA
Unitrap ID UNI31232

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 95481357..95481402 44
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000015850 (Adamtsl4) NM_144899 ADAMTS-like 4 Gene [Source:MGI (curated);Acc:Adamtsl4-001]

 
Come back to gene ENSMUSG00000015850


For any suggestions or comments, please send an email to unitrap@crg.es