Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14504F7
Clone ID IST14504F7
Vector VICTR74
Project tigm

Sequence tag IST14504F7HMF2
Sequence
NTTNGTGATTANNATTTCCNTTTTTGTTGTTTTTTNNTTTATTCNCATGANCTGCNTGGTGGTTTCNCNTNNGTTCTGTT
GCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14504F7BBF1
Sequence
CCTGGAAGAATTCNCAGCCACAGCAGCAAGCTCTCCTGGGCCCCAGCTCCGTTTGTGCCAGGTGTCTGGGCTGTTGCCGC
TGCGGCCAGGGTCTTCCCTTCGGATCT
Sequence Type genomic DNA
Unitrap ID UNI19360

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 69500414..69500519 104
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018752 (Tnfsf12) NM_001034097 tumor necrosis factor (ligand) superfamily, member 12 Gene [Source:MGI (curated);Acc:Tnfsf12-002]


Sequence tag IST14504F7HMR1
Sequence
GGGTGTCTAAAGAATCTGTANTGTTGGCCCCTCANANAACATGTGANTGTGGAACTTTGACNATTATTCANGGTCNGTGG
GACCGTCTCTANGTNTGCACANTGTATGCNCAGCGTCTCTGAGGANTCANGGTGTGCANGGAACATGAANGCTTNAGGNG
TAACCTTANTGTTGATGGANTTCANANTCTCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000018752


For any suggestions or comments, please send an email to unitrap@crg.es