Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XS0674
Clone ID XS0674
Vector pGT0lxf
Project sanger

Sequence tag XS0674
Sequence
ATATTTCCTTGCCTATTTCCACCCGCCTCCGTCCCTCATTGCTACTCAGACAGGTAAACCTTCCACCCTCGACTCTCCTC
CCGTTCCTCTCGCCCCCTCTTTCTTCTCGCGCCACTCCTACCCTAACCTCTATTTATATCCATCCGTCCAATTGCTTCAA
TGATATCTTGAAGGATCCCTTGATCTGCTCCTACTGATTCCGTTCATCATCTTCCTGGCGTTGAGCACCTTGGTACTAAG
TTTGGACTAGAACCATGGCGGTGACCAAAGAGCTCTTACAAATGGATCTGTACGCGCTGCTAGGCATTGAGGAGAAGGCG
GCAGACAAAGAG
Sequence Type mRNA
Unitrap ID UNI2177

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 119034424..119034518 93
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034278 (Dnajc17) NM_139139 DnaJ (Hsp40) homolog, subfamily C, member 17 Gene [Source:MGI (curated);Acc:Dnajc17-001]

 
Come back to gene ENSMUSG00000034278


For any suggestions or comments, please send an email to unitrap@crg.es