Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14801F4
Clone ID IST14801F4
Vector VICTR76
Project tigm

Sequence tag IST14801F4BBF1
Sequence
AGATGAAATATATTCAGGACTTCCAGAGGGAGAAACAGGAGTTCGAGCGAAACCTGGCCCGATTCAGGTAAGGCAGAGGA
GGGCTATGGGGCACTGGGTGCGGTAGGATAAACGTACTGTCTGAGACTAGAACTGACCGTCCATGAAACGTGGAAGTCTT
GTGTAGACTGTAGTGTCAGGTTCAGGGGCAGGGACAGGTTGCCAGCCACAAACTTCCACCGAGCTCCTGCAGGAAGGCCT
AAAAGGCTTGGCTTGGGCAGCTAGCTGGGGTCTGCCCTAGCGGTGTCCCCTGCTGACCCTTGCTCCGGTCCCCTGGTTAG
GGAGGATCACCCTGACCTTATNCNNAATGCNNNGAAGTCGGACATCCCCGANANACCCAAAACTCCCNNNNAACTGTGGT
ACACNCACNANANNANNGTGNATCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14801F4HMF1
Sequence
AGATGAAATATATTCAGGACTTCCAGAGGGAGAAACAGGAGTTCGAGCGAAACCTGGCCCGATTCAGGTAAGGCAGAGGA
GGGCTATGGGGCACTGGGTGCGGTAGGATAAACGTACTGTCTGAGACTAGAACTGACCGTCCATGAAACGTGGAAGTCTT
GTGTAGACTGTAGTGTCAGGTTCAGGGGCAGGGACAGGTTGCCAGCCACAAACTTCCACCGAGCTCCTGCAGGAAGGCCT
AAAAGGCTTGGCTTGGGCAGCTAGCTGGGGTCTGCCCTAGCGGTGTCCCCTGCTGACCCTTGCTCCGGTCCCCTGGTTAG
GGAGGATCACCCTGACCTTATCCAGAATGCCNAGAAGTCGGACATCCCCGAGAAACCCAAAACTCCCCAGCAACTGTGGT
ACACCCACGANAAGAANGTGTATCTNNAAGTGCGNNNGGATGTGAGTGTCTGGA
Sequence Type genomic DNA
Unitrap ID UNI3062

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 102172682..102173134 437
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020923 (Ubtf) NM_001044383 upstream binding transcription factor, RNA polymerase I Gene [Source:MGI (curated);Acc:Ubtf-002]

 
Come back to gene ENSMUSG00000020923


For any suggestions or comments, please send an email to unitrap@crg.es