Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14987E8
Clone ID IST14987E8
Vector VICTR76
Project tigm

Sequence tag IST14987E8HMF1
Sequence
CCTTGACTCTATGTGGGACTTGGGGATCAAACTCAGGTTGTTAGGCTGGTGGCAAACTTTTCCAAAGAGCCATCTCTAGC
CCCTACTCTGGGTTTTAAACATAGATTGATATACTGACAAGAGCCGAGGAACAGTTATTTTCAAAACTAACTCCACTAGT
TAATGTGCAACCACTAGCAAGTTATACAGTAGCCATGCAGTAAAATTTTCTCATGTGCAACAATCCTAGTGATGGTCTTT
AGAAATTATGATGATTAAATTAAGCATAATAAANTATGCACAAAGAACANNACTGCAGTAAGATACTTACTTTGAGCCTA
NGAATTTTAAAAAGTCTATTTCCAGCTTTNAAATGGTTTCATTANNACCCNCATTANGAAAGATTAANACNTNTGAGTTT
N
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 4993041..4993440 376
 
EST/CDNA Est Name
  AA080237.1 - BG802953.1 - BE380763.1 - CA883460.1 - BU514023.1 - CF170544.1 - CA579029.1 - CA874659.1 - CA579094.1 - CK393497.1 - BF164629.1 - CA548122.1 - CD554724.1 - CF160701.1 - CX227043.1 - CK393494.1 - BU503091.1 - BE534504.1 - BU503499.1 - CA564753


Sequence tag IST14987E8HMR1
Sequence
AGGGAGAGACCTAGCTCCTAAAAATTGTCTTGTCCTCTGACCTGTACACATATACCATGATACAGGTACACCCCTCCACT
ANTNANNTTGAGTAAAACTTAAAAACCTGGAGCTGGGATATGGTGGTAGAATGTGTGCTGGCACTGCAGAAATACTTAAG
GGGGAAAATTGACCAGGAGTTGGGAATATAGTTCTTTGGTAAATATGCNATATACTGGCTCCAGCCACCAACACCTCCTC
AAAAGCCAAGGATGACANACTCTANAATCTANAAAGTATTTGCCTACATTACCAAAAATTAATTACCTCANCTGGGCCTA
GTGGTAATGCACGCCTTGAATCCCAACAACAGGGGCATTGGCGGGTGGATCNNNNAATTTGGGCCACCCTGATTTACAAA
GCANGGTGTANGCTGGGACTGCACANTAN
Sequence Type genomic DNA
Unitrap ID UNI5404

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 4992616..4993043 396
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000009079 (Ewsr1) NM_007968 Ewing sarcoma breakpoint region 1 Gene [Source:MGI (curated);Acc:Ewsr1-002]


Sequence tag IST14987E8BBF1
Sequence
CCTTGACTCTATGTGGGACTTGGGGATCAAACTCAGGTTGTTAGGCTGGTGGCAAACTTTTCCAAAGAGCCATCTCTAGC
CCCTACTCTGGGTTTTAAACATAGATTGATATACTGACAAGAGCCGAGGAACAGTTATTTTCAAAACTAACTCCACTAGT
TAATGTGCAACCACTANCAAGTTATACAGTAGCCATGCAGTAAAATTTTCTCATGTGCAACAATCCTANTGATGGTCTTT
ANAAATTATGATGATTAAATTAAGCATAATAAAATATGCACAAAGAACAAGACTGCNGTAAGATACTTACTTNNAGCCTA
NGANTTTTAAAAANTCNNNTTCCNGCTTNACNATGGTTTNANNACAACCNNCATTNTGAAANATTAAAACTTNNNANTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000009079


For any suggestions or comments, please send an email to unitrap@crg.es