Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14122B9
Clone ID IST14122B9
Vector VICTR74
Project tigm

Sequence tag IST14122B9HMR1
Sequence
GGCCAAACAGGATATCTGTGGTAAGCAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14122B9BBF1
Sequence
AGCACAGCTTTCCTGTCNGAGGATAGGAACACTTGCTCTTTGAGCCCCGTGACCGACAGTGACCAGGGATTGGCATTCTT
GGATTGGCATGCTTTCCATTGTTACTTTGTCTATTTTGGTAAGAAAAACATCAANGGNNNCCTTGGGAATTTCAAAGGTT
GGAAATTATACGTTTATACTTTTATTAGTTTGCTCCAAGTATGACTGTGTTCACTTAAGTTTAGAGAAACACTGGGTTTT
GCTNAACTCGGTTC
Sequence Type genomic DNA
Unitrap ID UNI531

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 95466085..95466337 241
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038612 (Mcl1) NP_032588 myeloid cell leukemia sequence 1 Gene [Source:MGI Symbol;Acc:MGI:101769]

 
Come back to gene ENSMUSG00000038612


For any suggestions or comments, please send an email to unitrap@crg.es