Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10947B11
Clone ID IST10947B11
Vector VICTR76
Project tigm

Sequence tag IST10947B11HMR1
Sequence
TCNGTATGGTCCCTCAGCCTCCATTCGCTTTTACCAAGCGTCCTCCACATTCAGCGGTCTTTTGGGAGGGAGACTTAGAT
GCAAGGTGGCGGGATGGATACTCGACCTTGCCTCTCTGTCTGTTTTCTGTGACAGGTGCTGGAAATGGGGATGTGGTGCG
ATCTCCAACCAGTTCTATAGAGGAAAGATGTGTGGCCTCCAAATCTGCCAAAGC
Sequence Type genomic DNA
Unitrap ID UNI33941

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 156832021..156832233 211
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027635 (Dsn1) NM_025853 DSN1, MIND kinetochore complex component, homolog (S. cerevisiae) Gene [Source:MGI (curated);Acc:Dsn1-002]

 
Come back to gene ENSMUSG00000027635


For any suggestions or comments, please send an email to unitrap@crg.es