Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14495A6
Clone ID IST14495A6
Vector VICTR74
Project tigm

Sequence tag IST14495A6HMF1
Sequence
AGTTCTGGCTACACAACAGGGTCANACTANCCTGGANNACACNAGTCATTATCTCCAAAATAATGATTATATATATA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14495A6HMR1
Sequence
AACTGACTTTATTCTCTTGACCCTCCTGGCTTCCGAATTCTGGGGCTGCACGCATGCTCCACCTCACGAGTTTTTTAGAT
GAGCTGGTAAAGTCAGCAGGCTATAGGAGCTGGAGTAGTGACATGTGTGACAAAGATAAATTACCCCTGAAGCCCTAGAT
TTTAAACCTGAGTTCAGACACCTCCCCTCCTGAAAAGCAGTGTGTGTGTGTGGGGGGGGN
Sequence Type genomic DNA
Unitrap ID UNI5965

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 130493956..130494174 219
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074797 (Itpa) NM_025922 inosine triphosphatase (nucleoside triphosphate pyrophosphatase) Gene [Source:MGI (curated);Acc:Itpa-001]

 
Come back to gene ENSMUSG00000074797


For any suggestions or comments, please send an email to unitrap@crg.es