Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10498C4
Clone ID IST10498C4
Vector VICTR76
Project tigm

Sequence tag IST10498C4BBF1
Sequence
GTGAGCATCCACTTCTGTGTTTGCTAGGCCCCGGCATAGTCTCACAAGAGACAGCTATATCTGGGTCCTTTCGATAAAAT
CTTGCTAGTGTATGCAATGGTGTCAGCGTTTGGAAGCTGATTATGGGGTGGATCTG
Sequence Type genomic DNA
Unitrap ID UNI32329

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 150110684..150110819 136
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000000214 (Th) NM_009377 tyrosine hydroxylase Gene [Source:MGI (curated);Acc:Th-001]


Sequence tag IST10498C4HMF1
Sequence
NGGTCTTTGNGCGCACAGATAAGCAGGAGGGAAACAGGGAATGCTGAACACACAGGTTGTTCCCTCAAAGAAGAAAGAGC
TAGCCTGTTCTCCAGCAAGAGACTGATAGCTGTGCTCTGTGTGTCCTCACTCCAGGTGCTCCCAGACCCTTATTTCTTGT
TTCTCTCGGTCAATATANAACGCATGTTTCTAGAGAGTGTCACATGGNNNNNNCACAGAGTTGTAATATANNCNNGTCCN
ATCTTTAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000000214


For any suggestions or comments, please send an email to unitrap@crg.es