Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13944F1
Clone ID IST13944F1
Vector VICTR74
Project tigm

Sequence tag IST13944F1BBF1
Sequence
GGACCAGGGGTTGCAGATCATGCCCCAGACAAGGAACTGTATGCTANAGAAGCTTAAACCTGGGTGCTTGATAAAACATG
TTCATAAACTANAGTCCAGAATTGAACCCCCAGATCATCCTAGGATCTGCAATCCAGAGTAATAGGCAAACTACAGCCTG
AAATCTGGATGTCGGAAACAATGAANACATCTTGGAGCTAAAACTANAAGGGGTCTACAGGGCTANCGCTCANGANACAG
GCAAACCTTGCTTTCTCTCGAATCCCAGGNGCAAAGCGAAAACTGATTCATGAGGAAACACAGACAAAGCAGACATTTCT
ACACGTGGAGGGCAGTCTTACCCCTTCCCCGTCTCTGTTTCTAGTCNTTANGCTGTANGGCCTGGACATTTAANCCTTGG
CTGNTGCTACAGGGGCNGGGCTTGCCTTCTGCTGGGTGGACAGTCCCCGCAGTGACATCCTTTCN
Sequence Type genomic DNA
Unitrap ID UNI30609

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 83058380..83058843 436
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000079511 (Ccdc142) NM_001081266 coiled-coil domain containing 142 Gene [Source:MGI Symbol;Acc:MGI:3045292]


Sequence tag IST13944F1HMF1
Sequence
NGANCNNGGGTTGCNNANNANGCNNNNNACAAGGAACTGTATGCTANNANAAGCTTAAACCTGGGTGCTTGATAAAANAN
GTNCATAAACTANAGTCCAAAATTGAACCCCCANATCATCCTAGGATCTGCAATCCANAGTAATAGGCAAACTACAGCCT
GAAATCTGGATGTCGGAAACAATGAAGACATCTTGGAGCTAAAACTAGAAGGGGTCTACAGGGCTAGCGCTCAGGAGACA
GGCAAACCTTGCTTTCTCTCGAATCCCAGGAGCAAAGCGAAAACTGATTCATGAGGAAACACAGACAAAGCAGACATTTC
TACACGTGGAGGGCAGTCTTACCCCTTCCCCGTCTCTGTTTCTAGTCATTAGGCTGTAGGGCCTGGACATTTAAGCCTTG
GCTGTTGCTACAGGGGCAGGGCTTGCCTTCTGCTGGGTGGACAGTCCCCGCANTGACATCCTTTCCNAGGNAAGGAGCCN
NGATGTGGGGTGGTGCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000079511


For any suggestions or comments, please send an email to unitrap@crg.es