Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10573H1
Clone ID IST10573H1
Vector VICTR76
Project tigm

Sequence tag IST10573H1HMF1
Sequence
CAGGGGCTTTCAGCTTTTGTTTGCCCACTCTCTCTTTCCCTTCATCCCTCCCCAAACCTGAATTCCTTCCTTCCTGGGAT
CTGCCCTCACCCCAGCCTCCACCCTCCACCTGCCTGACCCTGAAGTCTTGACCTCTTATTTCAATAAAGCCATAGTGGGG
AGAGGTCTTGAGGGTGGGCCANCANGCCCTGTTCTGCTCATCCCCCACCATCACCACNATGCTTCCAGAATTGGGACCTG
GCCTTCTGANTCTTCCCCTCCCCACCCNCACCCCTGCTCCCCAATAAACACAAATACACATAGGCAGGGTGTGCCCATGC
AGGAAAGCTCCCTTCTGGCTGGNGGCTGNANAGGGGGTGTCNNANACAAGATCAAAGTGCCACACCNNAGGTTCCTCANG
CCTCTGAACCCCATTCTTACTCCCCTCCCCACACTTCCTTCCAGTGCTGGACTNACCTTNATCTTCCTGGTGANGACAGC
AAANGGAGCANGCACTTGGCTGGGGGTGGGGTGTTGGTTTTTGN
Sequence Type genomic DNA
Unitrap ID UNI30653

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 4777181..4777703 485
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000053550 (D430041B17Rik) NM_172737 RIKEN cDNA D430041B17 gene Gene [Source:MGI Symbol;Acc:MGI:3605641]


Sequence tag IST10573H1BBF1
Sequence
CAGGGGCTTTCANCTTTTGTTTGCCCACTCTCTCTTTCCCTTCATCCCTCCCCAAACCTGAATTCCTTCCTTCCTGGGAT
CTGCCCTCACCCCAGCCTCCACCCTCCACCTGCCTGACCCTGAAGTCTTGACCTCTTATTTCAATAAAGCCNTAGTGGGG
AGAGGTCTTGAGGGTGGGCCAGCAGGCCCTGTTCTGCTCATCCCCCACCATCACCACGATGCTTCCANAATTGGGACCTG
GCCTTCTGAGTCTTCCCCTCCCNANNNNNACCCCTGCTCCCCAATAAACACAAATACACATANGCAGGGTGTGCCCATGC
AGGAAANCTCCNTTNTGGCTGGNNNCTGNANAGGGGGTGTCANAGACAAGATCAAAGTGCCNCACCANANGTTCCTCANG
CCTCTGAACCCCATTCTTACTCCCCTCCCCACACTTCCTTCCAGTGCTGGACTNACNTNNATNTTCCTGGTGAGGACAGC
AAANGGNNCANGCACTTGGCTGGGGNTGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000053550


For any suggestions or comments, please send an email to unitrap@crg.es