Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10280B8
Clone ID IST10280B8
Vector VICTR76
Project tigm

Sequence tag IST10280B8BBF1
Sequence
CACTGTAGCTGTCTTCAGACACACCANAAGAGGGAGTCAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI10238 UNI11954 UNI31310 UNI31311 UNI31312 UNI31313

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166402: 2062..2105 42
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166438: 158107..158150 42
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000069661 (AC140325.3-201)  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr Y: 144675..144718 42
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 3854619..3854662 42
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024843 (Chka) NM_013490 choline kinase alpha Gene [Source:MGI (curated);Acc:Chka-002]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 3494115..3494158 42
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 3261568..3261611 42
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 4688829..4688872 42
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000004069 (Dnaja3) NM_023646 DnaJ (Hsp40) homolog, subfamily A, member 3 Gene [Source:MGI (curated);Acc:Dnaja3-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 8056405..8056448 42
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 5299702..5299745 42
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 8219624..8219667 42
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037669 (1110057K04Rik) NM_172401 RIKEN cDNA 1110057K04 gene Gene [Source:MGI Symbol;Acc:MGI:1916082]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 3251553..3251596 42
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 16142487..16142530 42
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 12776405..12776448 42
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021745 (Ptprg) NM_008981 protein tyrosine phosphatase, receptor type, G Gene [Source:MGI (curated);Acc:Ptprg-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 6144146..6144189 42
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 10074662..10074705 42
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 5681016..5681059 42
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029757 (Dync1i1) NM_010063 dynein cytoplasmic 1 intermediate chain 1 Gene [Source:MGI (curated);Acc:Dync1i1-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 3207917..3207960 42
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 6626120..6626163 42
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 11073362..11073405 42
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 19909994..19910037 42
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 5486424..5486467 42
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 11321859..11321902 42
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 6417288..6417331 42
NO GENE  


Sequence tag IST10280B8HMF2
Sequence
CACTGTAGCTGTCTTCAGACACACCANAAGAGGGAGTCAGATCTTGTTATGGATGGTTGTGAGCCACCATGTGGTTGCTG
GGATTAACGCN
Sequence Type genomic DNA
Unitrap ID UNI5272 UNI13133 UNI18964 UNI35594 UNI35595 UNI35596 UNI35597 UNI35598

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 7555552..7555636 83
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024758 (Rtn3) NM_053076 reticulon 3 Gene [Source:MGI Symbol;Acc:MGI:1339970]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 24226838..24226922 83
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 11263866..11263950 83
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 33934396..33934480 83
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 24930416..24930500 83
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035958 (Ttrap) NM_019551 Traf and Tnf receptor associated protein Gene [Source:MGI (curated);Acc:Ttrap-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 3520398..3520482 83
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 96656493..96656577 83
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018666 (Cbx1) NM_007622 chromobox homolog 1 (Drosophila HP1 beta) Gene [Source:MGI (curated);Acc:Cbx1-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 24626625..24626709 83
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 52964718..52964802 83
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 43292606..43292690 83
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 26873237..26873321 83
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 38323716..38323800 83
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 3207917..3208001 83
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 144842689..144842773 83
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 33228445..33228529 83
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028280 (Gabrr1) NM_008075 gamma-aminobutyric acid (GABA-C) receptor, subunit rho 1 Gene [Source:MGI (curated);Acc:Gabrr1-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 89971249..89971333 83
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027939 (Nup210l) nucleoporin 210-like Gene [Source:MGI Symbol;Acc:MGI:1924845]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 98840014..98840098 83
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034160 (Ogt) NM_139144 O-linked N-acetylglucosamine (GlcNAc) transferase (UDP-N-acetylglucosamine:polypeptide-N-acetylglucosaminyl transferase) Gene [Source:MGI (curated);Acc:Ogt-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 26835485..26835569 83
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000014852 (Adamts13) NM_001001322 a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 13 Gene [Source:MGI (curated);Acc:Adamts13-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 12753040..12753124 83
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000016918 (Sulf1) NM_172294 sulfatase 1 Gene [Source:MGI Symbol;Acc:MGI:2138563]

 
Come back to gene ENSMUSG00000016918


For any suggestions or comments, please send an email to unitrap@crg.es