Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14984C10
Clone ID IST14984C10
Vector VICTR76
Project tigm

Sequence tag IST14984C10HMR1
Sequence
TTCCCTCCTCTAAGGGGGGTGCACCAAAGAGTCCATTTAGGGAGCCAGTTGAAAATACAGCAGTGTTTACTTTATGGGCA
GCTGTGANTGTGGTAAGACAGGGAGAACCTTAAAATTGGCAGTTGTGTATAGCTTTGAGATAGAGGAATCTTGCTGTATA
GCCCTAGTTGGCCTAAAATCCCCTACGTAGATTAGGTTGGCCTTGAACTTGGGGTCCTCCTGCCTTTGACATCTCTATGC
TGGGCATTACAAATGTGTACCACCTTGCCAGCTTTAAATTTGAGATGTTAATCTAATTGTGATTGTTTCTTGATGGTTAN
TGTTAGAGAGGTATGAAGTTTTGAATGATTCTCANGCNCNTACATCTTGAGTTCAAAGATGTTGCTNANNTTTGGTCTTT
TTAAAAAATTTTTATATTTANTTNANATTGTGTTGGCCTGCN
Sequence Type genomic DNA
Unitrap ID UNI30144

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 91371024..91371430 377
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040549 (Ckap5) NM_029437 cytoskeleton associated protein 5 Gene [Source:MGI (curated);Acc:Ckap5-001]


Sequence tag IST14984C10HMF1
Sequence
AAGGAAGAGAAAAAGAGCAAGCAAGAGTGACCAAAACTTCTAGATTATATAGGGAGGAACCTCTGGGGGAAAGGGCAGCT
CAGCCCCTGGGCTGGGAAGTTGAGATCAGGGTATGCCTGGTTGGGACAGATGCTGTTCCCAACATGGAGCCAGGTCTGCT
TTGGTAAGTAAATATTCACCTCTGTCGCTTGTCCTCATTGGAAAACAAACACGAAGCTGCTGGTATCCGGGAGAGAGACA
GTTACTTTTCTTCTGCAGTCTCCGAATAGCAGGCTTCCTGGAAATTTGAGCTTTGTTGAGGGTCTTGGCTTTGGGAGAGG
AGGGTCTTTTANAAATAAGGGGTATGGNACCCCCANATTCCNCTTTCTCCCANGANCNNNACCCTCCCTNCTANNACTCT
N
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 49016293..49016692 374
NO GENE  

 
Come back to gene ENSMUSG00000040549


For any suggestions or comments, please send an email to unitrap@crg.es