Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10086F11
Clone ID IST10086F11
Vector VICTR75
Project tigm

Sequence tag IST10086F11BBF1
Sequence
ATGGCAAGAAAGGCACATTGAAATGCAGCTGTGTCTCATTAAGCAGCCGTGCTCCCTTCTGACCAGCGTGCCTGCCAGCG
TAGGCTGGCTCCCTCCCACCCTGTCTGGGAAGACTGAGGGAGACCTCAAGAGAGAGCTCTGACCTTGGCCTGAGAGCCAG
AGCAGAACCAGAGCTCCCGCTTCCAAGCAGGCCCTGTGTGTGCCGTGGTTGCAGCCTGGCCCCAAACTGGGTAGATACCC
AGGGAAGGAGCAGAGGAAACAGACTAGCACTGCAAACCTCAGCTGCCTCCACTCTCATGGCGGCCCTTGGAGGTCCTGGA
ACTAACTCTGTGGACCAGGCTGGCCTCAAACTCCCAGAGCTCCACCTGCCTCTTCCTTGCGCGTGCTGGGATTAAATGTG
TGTGCCACCCCTCCAGCTCAACCTTCGTCCTGCTTCTTCCGTGTTTAGGGGTAGTTTTTTGCGCCTTTGAGATACACAAA
AACATAGACACAGAAACTTTGTGAGACACCTGCTGGGAAGCTCAGCAACCTGCGTTCTCAGTCCCCAGGACCCA
Sequence Type genomic DNA
Unitrap ID UNI10744

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 114293387..114293940 552
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031954 (Cfdp1) NM_011801 craniofacial development protein 1 Gene [Source:MGI Symbol;Acc:MGI:1344403]


Sequence tag IST10086F11BBR1
Sequence
GCCTAAAGTGTGCCGTGATTTGTTTGCAGGGAGGAACTCTATGCTGCTAATTAATCTACTGAGGGAGCAAAATTGTCATT
AAAAATGGAAGACATAATTGAATCTCTGCACTAATTTTTCTTTGTTGCACCATGGAAAATGTGCATCTGTCACTACAAGG
TTATCACAGTCACGGTGAGAGTGTAACCAGTTCCGGGAACCTGTGTTCTTCACCGGGTTCAGGCCCTGTTTGCCTGCCCT
TCAGCACCCTGAAGAAAGCACAGTCTATTGCATCTGCTTGCCAGCCGAGCCTGTGGCTACTAACAATCCACACGAGGACT
GGTCAGAAAACGGTTCTTAGGCCAGAGGGCTAAATTAGAATCTTGTCACTCACTGTGTGTGCAGTATAAACTTAGCAGTT
CTAACAAAGTTATGTATGTATAGTGTTCGCACACACACACACACACTCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 114293940..114294385 442
 
EST/CDNA Est Name
  CD806886.1 - BQ043678.1 - BU696990.1 - BY433112.1 - BB689709.1 - BB689731.1 - CX567186.1 - CJ216410.1 - BY611115.1 - BB689730.1 - BB689157.1 - CJ218029.1 - CJ218443.1 - CJ302793.1 - CJ208399.1 - CJ217958.1 - CJ210040.1 - BY639701.1 - BY380601.1 - CJ208031

 
Come back to gene CD806886.1 - BQ043678.1 - BU696990.1 - BY433112.1 - BB689709.1 - BB689731.1 - CX567186.1 - CJ216410.1 - BY611115.1 - BB689730.1 - BB689157.1 - CJ218029.1 - CJ218443.1 - CJ302793.1 - CJ208399.1 - CJ217958.1 - CJ210040.1 - BY639701.1 - BY380601.1 - CJ208031


For any suggestions or comments, please send an email to unitrap@crg.es