Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14955H8
Clone ID IST14955H8
Vector VICTR76
Project tigm

Sequence tag IST14955H8BBF1
Sequence
NCCNGGACNCNTATTTGTATGGTCTACATTTTCNNTGGTTTAATATGCCTACCAAGAAATGATATTTTTGATTCTGAATA
TAAAGAGGTTCGTCTAGTTTAAACTTTAAAAGTTTTATTTTATTTATTTTTTATTTATTTTATGTTTTGCCTGCATGTAT
GTCTGTGTGAGGGTGTCNNATCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 55033958..55034138 167
NO GENE  


Sequence tag IST14955H8HMF2
Sequence
TTTGGCTACCATCAACCCAGCCCGCCAGCAGCCACACTTTGGA
Sequence Type genomic DNA
Unitrap ID UNI21628

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 79975832..79975872 41
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020709 (Centa2) NM_172133 ArfGAP with dual PH domains 2 Gene [Source:MGI (curated);Acc:Centa2-001]


Sequence tag IST14955H8HMR1
Sequence
ANNGANAAGTAGGAGAAAAATCATCCTTGCCNGGGCTGCTCCTGANAGACACAGGCGGCCTGGCCTCTTACCTCCTCCTT
GGTGTAGTACTTCAGGAGGCCTTCCCTCGACAGAAGGACAAACCGCCTTCTCAGGAACTGTGCGTTGTCCCGTCCTCGCT
TCCACAGGAACCCTTCTCGGTTACCTTAACCACCAAGGGCAAGAAATGAGCCATGAAC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 79975617..79975830 208
NO GENE  

 
Come back to gene ENSMUSG00000020709


For any suggestions or comments, please send an email to unitrap@crg.es