Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14646H9
Clone ID IST14646H9
Vector VICTR74
Project tigm

Sequence tag IST14646H9HMF1
Sequence
NAAGGAANTGGGCCNCTTGGGCTANNNANTGAGTCTGGTGTTTTTGAANCANGTTCTCGNTNTGTACCCNGANCTANTCC
TAACATCNCANATTGAAAG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14646H9HMR1
Sequence
CTTCTAGATTCTCAGANCCCGCAGTCCCCAGAAGGGAGCGAGGGCCCATCTTCTCCTCAACAATCCTTGAGCCTGTTTCC
TCAGCAGGAAAGGTCTGGTGGTGTCTTTAGTGGCTGCAGAGATAGGTGGGCATCCATAGTGCCACTTGGTAACACCGTGG
TCCTGGGCAAGTGGCTTGCTTACTTTAGGCTGTGCCAGGGTCCAGGCCTTTGAGGGGCGTGGGGAGGGGGCGAAGTTTGA
ATGGGACTNNTAAGGGCTAGGGCACNGNAGCTTGTANCTCCNCNCTGNANGCN
Sequence Type genomic DNA
Unitrap ID UNI22236

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 80878682..80878973 272
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000055053 (Nfic) NM_008688 nuclear factor I/C Gene [Source:MGI (curated);Acc:Nfic-004]


Sequence tag IST14646H9BBF1
Sequence
GAAGGAAGTGGGCCAGCTTGGGCTACATAGTGAGTCTGGTGTTTTTGAAGCAGGTTCTCGCTCTGTAGCCTGAGCTAGTC
CTAACATCACAGATTGAAAGGGGGGGTTGTATGTTGATTTTTTTTTTNCNNGGAT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 80878970..80879103 128
NO GENE  

 
Come back to gene ENSMUSG00000055053


For any suggestions or comments, please send an email to unitrap@crg.es