Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14598H2
Clone ID IST14598H2
Vector VICTR74
Project tigm

Sequence tag IST14598H2BBF1
Sequence
CCTGTATGTGTGGGCATGCACATTCCATGTGCATATGTGAAAGTCAGAGATACAGTTCTCTTTTTCCACTATGTGGGTCC
TGGGGGTCAAATCGTGTCATCAGGCTTGGCCAGAGTTGCCTTTACCCTCAGAGCCTCATCAGCCCAAGGTTTTCTTATTG
ATAGTCTCTGAGGTTTTTTTCTTTGCTTTGGCTTTTGGAGTCCTAGCTAAAATACCATTGCCCAATCAAATGATTCAGAG
TCACATTTATGTTCTCTAAAGAGTTGTTTAGTTCTTCCATTCATTTTGAGTTAGTCTTTTTTGTATATGATAATTTTGTG
TGTGTCACTAAGGTTACTATAACNNAAGCCCCTTANACTGGGCAACAAATTTATNANNAACAGTTTTAAAANTTAAGCCT
AAAATCNNCTGGGGG
Sequence Type genomic DNA
Unitrap ID UNI33739

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 3850942..3851355 396
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000054939 (AC129021.4-202) NM_001081217 zinc finger protein 174 [Source:RefSeq peptide;Acc:NP_001074686]

 
Come back to gene ENSMUSG00000054939


For any suggestions or comments, please send an email to unitrap@crg.es