Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15074A11
Clone ID IST15074A11
Vector VICTR80
Project tigm

Sequence tag IST15074A11HMR1
Sequence
TTGTAGAATAAATAGTGCTGGGGTAGTGTCTGACAAAGTACGTAGG
Sequence Type genomic DNA
Unitrap ID UNI20771

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 107179803..107179848 46
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032577 (Mapkapk3) NM_178907 mitogen-activated protein kinase-activated protein kinase 3 Gene [Source:MGI (curated);Acc:Mapkapk3-001]

 
Come back to gene ENSMUSG00000032577


For any suggestions or comments, please send an email to unitrap@crg.es