Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10916F2
Clone ID IST10916F2
Vector VICTR76
Project tigm

Sequence tag IST10916F2HMF1
Sequence
TTAGGAGACTTGCGGCACAATGAAGTTAANGANTGGCTTANCAGTTCTTGGGGTGTAGGCTGGGAGGCGCATCCACAAAG
ACTCTGGAGGGTGACACTTCAGCTGAGCGCTCAGGGACAGCGTTCCTGGGAAAGGAACAGGATGCACACAGCATGGAGGG
GCGAGAGAGCTGGAGAAAACAGGGAGAGAGAGCTTGGGAACCACAGATCTTAAGTCCGCTGTCTTANGAGGGGGCTTCTC
CTANNGCCANANAANGTTATCTGANCCGGTGGAGANGCCTTTGATGCTCTGTGCGGAGTGCTCTGTATTGACAGGAAACC
TTGGANGGATCTGGACAGATGGAAAGCCCTGTGTCTCCCTGGGCAACCTTANAAACAGANGCTTNCTGANGCAGCCTCAN
GTCACTCNNGCTGGCCTTGANCTTGCTTCGTAGCCTANAGTAACCNTGAGTGCCTGGATCTCTCTGCCCN

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST10916F2BBF1
Sequence
TTAGGAGACTTGCGGCACAATGAAGTTAANGAGTGGCTTANCAGTTCTTGGGGTGTANGCTGGGAGGCGCATCCACAAAG
ACTCTGGAGGGTGACACTTCAGCTGAGCGCTCAGGGACAGCGTTCCTGGGAAAGGAACAGGATGCACACAGCATGGAGGG
GCGAGAGAGCTGGAGAAAACAGGGAGAGAGAGCTTGGGAACCACAGATCTG

Sequence Type genomic DNA
Unitrap ID UNI29712

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 40213759..40213968 204
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040111 (Gramd1b) NM_172768 GRAM domain containing 1B Gene [Source:MGI (curated);Acc:Gramd1b-002]


Sequence tag IST10916F2HMR1
Sequence
ATGGGAATGCCANGTGTTTCCTTNATACAGTGATGGTGTGAGCTAAGTAAAACTGTAGCAAGCTGTACAACGCACTTAGG
AAAGCCGAGGCACAGGAAAGACGTAACTGAGCAGTTTGACCAAGTTCCTCTTAGTTTCTTTATTCTCATATGCTTCTTAG
TTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 4965058..4965218 156
 
EST/CDNA Est Name
  BY192386.1 - BY177004.1 - BY176644.1

 
Come back to gene BY192386.1 - BY177004.1 - BY176644.1


For any suggestions or comments, please send an email to unitrap@crg.es