Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_164B9-3
Clone ID CMHD-GT_164B9-3
Vector Gep-SD5
Project cmhd

Sequence tag CMHD-GT_164B9-3
Sequence
GCTATTTTGGTGCCTTAATGAAGAATCGGATTTTGAAGTGGCCTTCAGCTTGGGAGCCAATGGCGTCATGACCGATTACC
CCACAGCCCTGAGACACTACCTGGACAAGCAGGAAGAAGAGACCCAGCCTCCTCAGCCCTGAGGCCCTGTCCTGTCTTTT
CTCTTAAAAAATAAATATTTCCTGGTCAGC
Sequence Type mRNA
Unitrap ID UNI13946

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 133918970..133919156 177
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000030703 (Gdpd3) NM_024228 glycerophosphodiester phosphodiesterase domain containing 3 Gene [Source:MGI Symbol;Acc:MGI:1915866]

 
Come back to gene ENSMUSG00000030703


For any suggestions or comments, please send an email to unitrap@crg.es