Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12331B2
Clone ID IST12331B2
Vector VICTR76
Project tigm

Sequence tag IST12331B2HMF1
Sequence
CCTGCTGATCCAATTCATCTGAAGTCAAACATGCATTAAAAACACCAGCCTAGGGGCTGGTGAGATGGCTCAGTGGGTAA
GAGCACCCGACTGCTCTTCCGAAGGTCCGAAGTTCAAATCCCAGCAAGCACATGGTAGCTTACAACCACCCGTAATGAGA
TCTGATGACCTCTTCTGGTGCATCTGAAGATAGCTACAGTGTACTTACATATAATAAATAGATAAATCTTAAAAAAAAAA
ANNNAAAAN
Sequence Type genomic DNA
Unitrap ID UNI6310

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 86591049..86591296 242
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018425 (Dhx40) NM_026191 DEAH (Asp-Glu-Ala-His) box polypeptide 40 Gene [Source:MGI (curated);Acc:Dhx40-001]


Sequence tag IST12331B2BBF1
Sequence
CCTGCTGATCCAATTCATCTGAAGTNAAACATGCATTAAAAACACCAGCCTAGGGGCTGGTGANATGGCTCANTGGGTAA
GAGCACCCGACTGCTCTTCCGAAGGTCCGAAGTTCAAATCCCAGCAAGCACATGGTAGCTTACAACCACCCGTAATGAGA
TCTGT
Sequence Type genomic DNA
Unitrap ID UNI6310

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 86591133..86591296 158
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018425 (Dhx40) NM_026191 DEAH (Asp-Glu-Ala-His) box polypeptide 40 Gene [Source:MGI (curated);Acc:Dhx40-001]

 
Come back to gene ENSMUSG00000018425


For any suggestions or comments, please send an email to unitrap@crg.es