Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14656G8
Clone ID IST14656G8
Vector VICTR74
Project tigm

Sequence tag IST14656G8BBF1
Sequence
GCGCACACCTTTAATCCCAGCACTGGGGAGGCAGAGGCAGGGGAATTTATTTTTATTTTATGTATACGTGTGTTTTGCCT
ACATGTATGTATGTGTAGCACATGTTTTTATGCATGTGAAGGCTAGGAGAAGGCATGAGATCCCCTGAAATTGAATTCAC
AGAAGATTGTGAGGGTGTTCAGAATCGAACATGGGGCCTTCAGTAAGAGCAACAAGTGCTTTCTGACTGCTGAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI26226

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 108603876..108604113 238
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032601 (Prkar2a) NM_008924 protein kinase, cAMP dependent regulatory, type II alpha Gene [Source:MGI Symbol;Acc:MGI:108025]

 
Come back to gene ENSMUSG00000032601


For any suggestions or comments, please send an email to unitrap@crg.es