Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14631C10
Clone ID IST14631C10
Vector VICTR74
Project tigm

Sequence tag IST14631C10BBF1
Sequence
AGAATAAGGGAGTGAGAGAGCGAGAGAGAATAAGAGAGAGAGAGAGAGAGAGAGAGTGAGAGCANGCNCCCTANGCAGAG
CTGCCCACTCAGCGAACAGTGGTGAGTGTACCGTCCTGGCCTCCTCACACACAANAACCNNGGGAANCTGGGGTGTGGTA
NCAAANNCTTTTANTCCCNCCACACANGANGTGGANGCNCGCATATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14631C10HMF2
Sequence
AGAATAAGGGAGTGAGAGAGCGAGAGAGAATAAGAGAGAGAGAGAGAGAGAGAGAGTGAGAGCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 20326247..20326309 63
NO GENE  


Sequence tag IST14631C10HMR1
Sequence
TTCTCTCTCGTTCTCTAGATGGTTGTAAGCAGTTCCTCATAGAGACAAGTCATGTGTCCCTCACCTCAGGGCTCACTGTC
AAT
Sequence Type genomic DNA
Unitrap ID UNI10803

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 20326168..20326250 83
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000062300 (Pvrl2) NM_008990 poliovirus receptor-related 2 Gene [Source:MGI Symbol;Acc:MGI:97822]

 
Come back to gene ENSMUSG00000062300


For any suggestions or comments, please send an email to unitrap@crg.es