Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14716H4
Clone ID IST14716H4
Vector VICTR76
Project tigm

Sequence tag IST14716H4BBF1
Sequence
CACATAGTGGCTCACAACCATCCATAATGAGATCTN
Sequence Type genomic DNA
Unitrap ID UNI33946 UNI33947 UNI33948

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 106980428..106980462 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 3272847..3272881 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 46090402..46090436 35
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037712 (Plekhc1) NM_146054 fermitin family homolog 2 (Drosophila) Gene [Source:MGI (curated);Acc:Plekhc1-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 17404173..17404207 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 27721222..27721256 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 28913521..28913555 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 23808927..23808961 35
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074667 (AC108797.8)  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 10965408..10965442 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 36557863..36557897 35
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029093 (Sorcs2) NM_030889 sortilin-related VPS10 domain containing receptor 2 Gene [Source:MGI (curated);Acc:Sorcs2-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 59906340..59906374 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 33665359..33665393 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 55243870..55243904 35
NO GENE  


Sequence tag IST14716H4HMF2
Sequence
CTATATATCTACAAGTCTGATAATCTGTCTCACACACATTCTCTATGAATGATTATTATTCACCTGACTACATTTTCTTT
TCAGGGTCTTCTTTCTTTTCTTTTCTTTTCTTTTCTTTTCTTTTCTTTTCTTTTCTTTTCTTTTCTTTTCTTTTCTTTTG
TATTTATAACCACCTATTGAATTCAATTTTCATATCCTATGTTGTCCTCATTTCCTTAAGGAAATTTCTCCTCACAAGTA
CCTTGCTGCAATCCTGTCTTCATGTTTTATTCAAACCTAAGGTGTGACATTAATAACAAAGCATATGTAGACACATTTCT
CAATGATGTATTTACATCAAAGTATGCNTATACCTCTGTGTTNANATAAACGGANANNATNACTTTGCTTGGTTAATGTT
AATATTTACNGCCNTATGATGGTGCNNTATAANGG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 145261179..145261609 406
 
EST/CDNA Est Name
  AI503178.1 - BY309068.1 - AA183533.1

 
Come back to gene AI503178.1 - BY309068.1 - AA183533.1


For any suggestions or comments, please send an email to unitrap@crg.es