Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XS0253
Clone ID XS0253
Vector pGT0lxf
Project sanger

Sequence tag XS0253
Sequence
CTCTATAGGCCAGTTCGTCAGTATGTTTACGGAGTCCTGTTTAGTTTGGCAGAAAGCAGAAAGAAAACTGAGAGACTTGC
TTTTAGAAAGAACAGACTTCCACCAGAATTCTCGCCACTGATCATTAAGGAGTGGGCAGCTTACAAGGGGAAATCTCCTC
AGACCCCGGAACTAGTGGAAGCATTGGCCTTCCGGGAGTGGACCTGCCCCAACCTGAAGAGGCTTTGGCTGGGCAAGGCG
GTGGAGGACAAGAACCGCCGGATGAGGGCCTTCCTGGCCTGCATGAGGTCTGATACCCCAGCCATGCTCAACCCTGCCAA
TGTGCCCACTCACCTCATGGTGCTCTGCTGCGTCTTACGGTATATGGTGCAGTGGCCTGGAGCTCGCATTCTGCGAAGGC
AGGAGCTGGATGCCTTCCTGGCTCAGGCATTGTCCCCCAAACTCTATGAGCCGGACCAGCTGCAGGAACTCAAG
Sequence Type mRNA
Unitrap ID UNI2185

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 48993029..49005733 252
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038014 (BC010304) NP_001028440 family with sequence similarity 120, member A Gene [Source:MGI Symbol;Acc:MGI:2446163]

 
Come back to gene ENSMUSG00000038014


For any suggestions or comments, please send an email to unitrap@crg.es