Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14989E1
Clone ID IST14989E1
Vector VICTR80
Project tigm

Sequence tag IST14989E1HMR1
Sequence
GTCTGACCCTTGTAGCCTGCGCCCATCCAGCCCGCACTCCCGCCCCCAGTCCCCGAAGTCAGGTTTTCGAACTTATTGAG
GCTTTCTTTTCTTCTGTCTTTTCTTTCCTTATTTTTAGACAGGGTCTTGCTGTGTAGCCCAGGGTAGCTTGGAGCTAACA
GCAATTCTGCTGCCTCAGCCTTCAGTCATAGGCATGGACCACCAAACCTGGCTTCTTTTTGAATTGTTTTAGCCTCTGTG
GACAGAGATTTTGTTTGTTTTTCTGGATTTTGGACTTTCCCTCAAGGCTGATACAAACTCCTTTTTGAGTACCTTTGCGT
TCTCCCTGGGGGCAGGGAGCTGGTATCTTCTTTGCACCTATTTGAGTGGGCTTTGTGTACCAAGCTGTGGAAATTTATGT
ATATTTTCTCTTGTGTTTATGACTTTTATTTTAAAATTGCTCTGCACATTTACGTTCATGTCGGGTCCATTCTTCTGTGT
GTGGCTTGNCCCCGANCTTTGCAGAGTANCTCTCCGCCTTTTACTTGTCTCTCCTCCNGCATCACTTTGTGCNCTTCNTC
CACNCAGCCCTTGANTTTATTTGTTCTCACTGCTGAANNGTCC
Sequence Type genomic DNA
Unitrap ID UNI10487

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 32019557..32020157 578
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039262 (5830434P21Rik) NM_172661 RIKEN cDNA 5830434P21 gene Gene [Source:MGI Symbol;Acc:MGI:1923304]


Sequence tag IST14989E1HMF1
Sequence
AGACAAGCCCTCAACCACTGAGTTCCACCTCTAGCTCCTCAAACCCTCAAATCGATGAAGAACTCAGGCCCTTTGAAAAG
CAGAGGGACCCACTCCAAGTTCAAGACCAGCCTGGTTTACATAGTGAGTCTCATGTCACGGACAGATACCTCCTTTCAAC
AAACCAACCAACCCAAAAAAAGATTTTAAAATAGAGAATTTAAACAACCTGGTATGTTACTCACACCTGCCATCCTAAAC
TCAGTAGGCAAAGAGGGGCGTTGGGGGTTCCCGGGGGTACCTGCCTTTCTCATAAACCAGAAAAAAGGGGAGGTGTTCTG
GAGAGAGAACTCAGCAGGTAAGANCAGAATCTGGTTCCCAGCACCCACAACACGCAGTTCACAGCCNCCGTGTAACTCCA
GCTCCNGGANACCTANCGACTGNCCTCTGGNNTTCTTTANCCGCCGCTGCCNNTGCCGCCGCCCCCACCACCGCCGCCNN
NNGCACCACCACCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 32019068..32019560 463
NO GENE  

 
Come back to gene ENSMUSG00000039262


For any suggestions or comments, please send an email to unitrap@crg.es