Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12632F2
Clone ID IST12632F2
Vector VICTR76
Project tigm

Sequence tag IST12632F2BBF1
Sequence
TACTGTTATACTGTTATGAATCACAATGTAAATATCTGCCTGAGGCGACCGCTGTGAAAGGGTCATTTGACACCTCCAAA
GGGGTCATGACCTACAGGTTGAGAACGGCTGCTGAAGATGAACTGGTTAAGTGGCTGCCTATAGAATAGTTGGGTAAGTG
TGTTTGGTGACCCATACAGAAAGAAAGCTCTGTTTCACTAAAGTCCTTTTGGCCTTGTTTATACTTTCTTTAACCTTGGA
CATGAGAACATAAAGACAGGAGATGTCTTCTGTTCCTAAAGTTCCTAAGACACTTTTTCTTTGTTACCAAGCAGCCTACA
CAGAAACAACAAGAAGTGACAGAGATAAGGCAGAGAATAAAATCCGTATGGATGTGTCTTGAAAATAACCNTGGGACACA
GGGCANTTGTGGCANACGCNTTNNATCCCACTTGGGAGNCANAN
Sequence Type genomic DNA
Unitrap ID UNI29081

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 35951734..35952174 427
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022906 (Parp9) NM_030253 poly (ADP-ribose) polymerase family, member 9 Gene [Source:MGI (curated);Acc:Parp9-001]


Sequence tag IST12632F2HMF1
Sequence
TACTGTTANACTGTTATGAATCNCAATGTAAATATCTGC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000022906


For any suggestions or comments, please send an email to unitrap@crg.es