Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13652C8
Clone ID IST13652C8
Vector VICTR74
Project tigm

Sequence tag IST13652C8HMF2
Sequence
CTTTCTCTGTGATAACTCCAGCTGTGTCAAGTTCC
Sequence Type genomic DNA
Unitrap ID UNI33950

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 117803695..117803728 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 31244100..31244133 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 69831919..69831952 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 14432623..14432656 34
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000056296 (Synpr) NM_028052 synaptoporin Gene [Source:MGI (curated);Acc:Synpr-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 23151580..23151613 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 150234869..150234902 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 68504825..68504858 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 60170673..60170706 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 15468429..15468462 34
NO GENE  


Sequence tag IST13652C8BBF1
Sequence
CTTTCTCTGTGATAACTCCAGCTGTGTCAAGTTGACACAAAAACTAGCCAATACACAGGCTAATACAGAGAAGGAGCCAA
AAATCTTTACTGTGGGTCAGCGCTATTCTCCAAGACCCTACAATCAAAGGTCATAGCGAGCATGCCTGTAATCCAAGCCC
TTGGGAGACTGAGGCANAAGTGTGAGTTCAAGACCGGCATAGGCTACCCAGTGACTTTGAAGAGAGCCTTGGCTACATAG
TAATAAGAAAAAATAAAACAAAACAAGTTGGAGACAATGGCACACACCTGTAATCCCAGCGTGTGGGAAGCGGAGGCCGG
CAGATCCCGGAAGTTTGAGGCCCGCCTGGGTGTANAATGATACTTTGTCTCAAAAGANTAGAAAAATTGCTGGGGTGGGG
AATGGCACATGCCTTTAATCCCAGCACTAGAGAGGACAGAGGCNNGTGGATCTCTGTGANTTCACAGCCNGTTTGANCTN
GGNATTTCCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 29442146..29442634 469
NO GENE  

 
Come back to gene ENSMUSG00000056296


For any suggestions or comments, please send an email to unitrap@crg.es