Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12605D3
Clone ID IST12605D3
Vector VICTR76
Project tigm

Sequence tag IST12605D3BBF1
Sequence
GTCATAAATGTGTTGTTGTGGTTTAAAAAAAAGTTTTGCTCTTACTGAAAATAGACTTTTTCCTCACATAATATCCTGAA
TACAATTTCCCCTCCTTCTACTCCTCTCAGTTCCTCCCTGCCTTCCCATCTACCTCAATCTACTTCTTTGCTCTCCTTCA
ATAAATAAATAAATAAATAAGTAAATAAATAAGTAAATAAATAAATAANTGGTTANCTGGGCAATGGTGGCNCACGCCTT
TAATCCCAGCNCTGGANAGGCANAGGCTGGTGGATTTCTGANACGGCCTGGTCTACAGAGTGAGTTCCAGGACAGCCATT
AATATATAGAGATAGGAACCCTGTCTNAAACAAAGACAAAAACAAAGTCNAACTAAAGTCCNGANCCNTCCCCANCAGCA
GCTCTTCATGTTTCTCNGAGGAGACNATGGATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 154162590..154163022 403
 
EST/CDNA Est Name
  BB788239.1 - BY659288.1 - BB738210.1 - BB834332.1 - BY544012.1 - BY559565.1 - BB791328.1 - BB329807.1 - BB733529.1 - BB311779.1 - BB313784.1 - BB735652.1 - BB773411.1 - AI152002.1 - BB230821.1 - BB352498.1 - BB038133.1 - BB218147.1 - AA929787.1 - AI005862


Sequence tag IST12605D3HMF1
Sequence
GTCNNNNATGNGNNANTNTNGNTTNTANNAAANANANNNNTNNNCNNANAAACCCTATCTTGAAAAATAAACAAACAAAA
ATCCTAAGGATGGCTTTAACTAGGTCAGTTTGCATCCTAAGTCATTCCANAGGCTGGAGGATGGCTCTGTGCNNGNCN
Sequence Type genomic DNA
Unitrap ID UNI11490

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 154163063..154163165 101
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027487 (Cdk5rap1) NM_025876 CDK5 regulatory subunit associated protein 1 Gene [Source:MGI (curated);Acc:Cdk5rap1-001]

 
Come back to gene ENSMUSG00000027487


For any suggestions or comments, please send an email to unitrap@crg.es