Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14414F5
Clone ID IST14414F5
Vector VICTR74
Project tigm

Sequence tag IST14414F5HMF1
Sequence
TTTGTTTGTTTGTTTGTTTTGAGACAGGGTTTCTCTGTG
Sequence Type genomic DNA
Unitrap ID UNI97 UNI4735 UNI32382 UNI33951 UNI33952 UNI33953

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 10888208..10888246 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 8610901..8610939 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 13144238..13144276 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 20297274..20297312 39
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000059229 (BC099486) 6030426L16Rik protein [Source:UniProtKB/TrEMBL;Acc:Q4KL22]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 6408933..6408971 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 33308763..33308801 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 6346553..6346591 39
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022150 (Dab2) NM_023118 disabled homolog 2 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:109175]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 8646537..8646575 39
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022711 (Pmm2) NM_016881 phosphomannomutase 2 Gene [Source:MGI (curated);Acc:Pmm2-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 12999923..12999961 39
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000064070 (2810051F02Rik) RIKEN cDNA 2810051F02 gene Gene [Source:MGI Symbol;Acc:MGI:1919954]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 5253686..5253724 39
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000050945 (Zfp438) NM_178722 zinc finger protein 438 Gene [Source:MGI Symbol;Acc:MGI:2444919]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 8808080..8808118 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 29616288..29616326 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 5691197..5691235 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 28051921..28051959 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 24705754..24705792 39
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028938 (Galntl5) NM_026449 UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 5 Gene [Source:MGI (curated);Acc:Galntl5-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 22416628..22416666 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 4482979..4483017 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 83239699..83239737 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 7457062..7457100 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 12891408..12891446 39
NO GENE  


Sequence tag IST14414F5HMR1
Sequence
AAACAAAAAAATGTGTGTGTGTGCAGGTGCACATGTCTATGTGGGTGGAGGCCAGAGGTCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 33299513..33299572 60
NO GENE  

 
Come back to gene ENSMUSG00000028938


For any suggestions or comments, please send an email to unitrap@crg.es