Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12526H5
Clone ID IST12526H5
Vector VICTR76
Project tigm

Sequence tag IST12526H5BBF1
Sequence
CTTCCAGCAGGACACACCTGAGACTTGGCTTTATGGGTGTCAAACAATAGATCCTGTATTTAAAACTGGATCGAGTCTGA
GGTTTTTATCCCAGGACTCTCAAAGTCTATAACACCAATTATCATATCCCTTTTCCTTCATGCTCCTCAGCCTATCCCCA
GTCACTCATAGCAAACTAACACATTTATGTAATTCCATTATACAAATATAACACTATGCAGTTTCCGGAAATGCAAAGTC
CACAGAAAACATTGTTAACAGTTTGCACAGCTCTATGACATTTTCCCCCTCAAAGATTTCTAGAATGCTCTCAAGATACT
GGAACATGATTGAATTCTCACAGGGGCCCCACCCTCACAATTCCCATCTCTGCTGTGCCCAGAGTACCCTAAACAAAGTT
TCAGTTCATCAACTGCATAGGTGAGTTACCTGATGATGGTNAAGCTCTGGCCCCCATAGCGAGGCACCCGANGCACCCGA
NGCACCCGCGGGCGCGCAGCATCTTGCNNNNCCNGCGCGTGAGGCNCCTCGCCCAACTTCCTTTGAACTCTNNACGGCTG
AN
Sequence Type genomic DNA
Unitrap ID UNI21347

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 30763298..30763859 536
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033826 (Dnahc8) NM_013811 dynein, axonemal, heavy chain 8 Gene [Source:MGI Symbol;Acc:MGI:107714]


Sequence tag IST12526H5HMF1
Sequence
CTTCCAGCAGGACACACCTGAGACTTGGCTTTATGGGTGTCAAACAATAGATCCTGTATTTAAAACTGGATCGAGTCTGA
GGTTTTTATCCCAGGACTCTCAAAGTCTATAACACCAATTATCATATCCCTTTTCCTTCATGCTCCTCAGCCTATCCCCA
GTCACTCATAGCAAACTAACACATTTATGTAATTCCATTATACAAATATAACACTATGCAGTTTCCGGAAATGCAAAGTC
CACAGAAAACATTGTTAACG
Sequence Type genomic DNA
Unitrap ID UNI21347

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 30763298..30763556 259
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033826 (Dnahc8) NM_013811 dynein, axonemal, heavy chain 8 Gene [Source:MGI Symbol;Acc:MGI:107714]

 
Come back to gene ENSMUSG00000033826


For any suggestions or comments, please send an email to unitrap@crg.es