Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10924D8
Clone ID IST10924D8
Vector VICTR76
Project tigm

Sequence tag IST10924D8BBF1
Sequence
GAGCACTGTCTTGTTTCTTTCTCACTTGTTATTACTGTGCATCTTTGATGTTGTTGATTTGCAAAATTTAACAACCTTAN
AACCCTGTCTCTATATCCCTAGGCTCCTTTGTGTGCAGGTTGGGTTGCGGATGGGAATGTGTTTGTGTACNCACAANCAC
ACAGTCACATGGGAAATCCAGGGATCT

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 35231659..35231844 180
NO GENE  


Sequence tag IST10924D8HMF1
Sequence
CAGACCAGGCTGGCCTCAAACTCAGAAATCCTCCC
Sequence Type genomic DNA
Unitrap ID UNI32558 UNI32559 UNI32560

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 79771210..79771243 34
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035575 (Utp6) NM_144826 UTP6, small subunit (SSU) processome component, homolog (yeast) Gene [Source:MGI (curated);Acc:Utp6-002]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 31707410..31707443 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 15786990..15787023 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 134488192..134488225 34
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028821 (Syf2) NM_026780 SYF2 homolog, RNA splicing factor (S. cerevisiae) Gene [Source:MGI (curated);Acc:Syf2-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 122279539..122279572 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 64919477..64919510 34
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032393 (Dpp8) NM_028906 dipeptidylpeptidase 8 Gene [Source:MGI Symbol;Acc:MGI:1921638]

 
Come back to gene ENSMUSG00000032393


For any suggestions or comments, please send an email to unitrap@crg.es