Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13084A6
Clone ID IST13084A6
Vector VICTR76
Project tigm

Sequence tag IST13084A6BBF1
Sequence
GATTGCTGGCTTTCTTTGGCTCTGACCTTTACTAATGTCTAATTTCTTTTCTTTCTGATATGAGATCTGT
Sequence Type genomic DNA
Unitrap ID UNI21437

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 48831032..48831100 69
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032267 (Usp28) NM_175482 ubiquitin specific peptidase 28 Gene [Source:MGI Symbol;Acc:MGI:2442293]


Sequence tag IST13084A6HMF1
Sequence
GTGTAANACTGGCTGTCCTGGAACTCACTCTGTAGGCCAGGCTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 74916128..74916170 41
NO GENE  

 
Come back to gene ENSMUSG00000032267


For any suggestions or comments, please send an email to unitrap@crg.es