Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15088E9
Clone ID IST15088E9
Vector VICTR80
Project tigm

Sequence tag IST15088E9HMR1
Sequence
NGAAGACCCACTCCCCGGCGCCGCTCGTGGGGGGCCCAAGTCCTTCTGATCGAGGCCCAGCCCGTGGACGGTGTGAGGCC
GGTAGCGGCCCCCGGCGCGCCGGGCTCGGGTCTTCCCGGAGTCGGGTTGCTTGGGAATGCAGCCCAAAGCGGGTGGTAAA
CTCCATCTAAGGCTAAATACCGGCACGAGACCGATAGTCC
Sequence Type genomic DNA
Unitrap ID UNI28357

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 147072574..147072771 186
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029635 (Cdk8) NM_153599 cyclin-dependent kinase 8 Gene [Source:MGI (curated);Acc:Cdk8]

 
Come back to gene ENSMUSG00000029635


For any suggestions or comments, please send an email to unitrap@crg.es