Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12932H7
Clone ID IST12932H7
Vector VICTR76
Project tigm

Sequence tag IST12932H7BBF1
Sequence
CTCTGAGTTGCTAGATAATTATTAATTATATTAGGTAAATTGTCATAACTTAAGCATTGTAACTTAAATGAATGTTTGTA
CCTACTACCTTAATCTTGTGAATTTGTGTTTTGCTCTGCTCCTTTTTAATTTTAATTAGGCTCTCCTTTGTTTTAATTTC
ATTTTAATTCGTTTTATATGAGTTTGAATAATACACTTACTAAGTCTTGTCAGTATTTGCTTTTTTTGATGTTTTGTTTT
ANAGGCAGGAATTCACTATGTANTCCTGCCTGGCCTCTAGCTTACAGAAGGCCATTTGCTGCTCANGTGCNNGGNTTAAA
GATGTNTGCCNCCACACCTGGTTGTATTTNNACTTCNGGCN
Sequence Type genomic DNA
Unitrap ID UNI2859

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 55001297..55001656 338
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000060206 (Zfp462) NM_172867 zinc finger protein 462 Gene [Source:MGI (curated);Acc:Zfp462-001]


Sequence tag IST12932H7HMF1
Sequence
CTCTGAGTTGCTAGATAATTATTAATTATATTAGGTAAATTGTCATAACTTAAGCATTGTAACTTAAATGAATGTTTGTA
CCTACTACCTTAATCTTGTGAATTTGTGTTTTGCTCTGCTCCTTTTTAATTTTAATTAGGCTCTCCTTTGTTTTAATTTC
ATTTTAATTCGTTTTATATGAGTTTGAATAATACACTTACTAAGTCTTGTCAGTATTTGCTTTTTTTGATGTTTTGTTTT
ANAGGCAGGAATTCACTATGTANTCCTGCCTGGCCTCTANCTTACAGAAGGCCATTTGCTGCTCAGGTGCNNGGATTAAA
NATGTATGCCACCACACCTGGTTGTANTTTGACTTCTGGCCNCCCACCCCCTGCCTTTTANACATGCTNNGTCTTTANAT
CANTTNANTANTANTTTNGCTTTAANAAANTNNANTNNNANTTNNNAANCNNAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000060206


For any suggestions or comments, please send an email to unitrap@crg.es