Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10126E11
Clone ID IST10126E11
Vector VICTR76
Project tigm

Sequence tag IST10126E11HMF1
Sequence
TTTTGGTTTTTCGAGACAGGGTTTCTCTGTATAGCCCTGGCTGTCCTGGGACA
Sequence Type genomic DNA
Unitrap ID UNI3901 UNI29961

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 78453796..78453847 52
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 55629409..55629460 52
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 125657794..125657845 52
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 151539897..151539948 52
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034021 (Pds5b) NM_175310 PDS5, regulator of cohesion maintenance, homolog B (S. cerevisiae) Gene [Source:MGI (curated);Acc:Pds5b-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 53627835..53627886 52
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042195 (Slc35f2) NM_028060 solute carrier family 35, member F2 Gene [Source:MGI Symbol;Acc:MGI:1919272]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 81001781..81001832 52
NO GENE  


Sequence tag IST10126E11BBF1
Sequence
ATATTTTATGTGACATTTTTGGCAGACCTGGATCGTCTGGGTTTGGAGCCTGAAGCAGGCAGCTCAGCTAAGTTCCAAAT
TCCTCGCAGAGCTGGGCCAGGAAAGTGTGAAAACATGCTTGGAATTCCAAAAATGTGCCCTGTCTGGGGCCTCTGCCTGC
CTTTCTCCAGACCCTCAGGGAGTCAAAGACAGGGTCTGGAGCCTCCCACCCTCTGTAGACAAAGAAAGAAAAACTCTGTC
CTCGCACAAACAGGGTGATTGCTATAGTCGTGCTGGAGATGTAAGACTCCCACCCCCACCCATCCCATCCCCCCACTCCT
AGGGTCTGGAGAGATCGCTCAGCCTTTAAGAGCACTGGCTACTCTTCCAGAGAACCCTGGTTCAATTCTCAGCAACCCAC
AGGGCAGCTCACACCTGCCTGTGACCCCAGTTTCAGTACTTCTAACACCCTCATATATGCAGTCAAAACACTAATGAACA
TAAAATAAAAATAAATTACACATATTGGGT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 36074037..36074546 508
NO GENE  

 
Come back to gene ENSMUSG00000042195


For any suggestions or comments, please send an email to unitrap@crg.es