Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11504C7
Clone ID IST11504C7
Vector VICTR76
Project tigm

Sequence tag IST11504C7BBF1
Sequence
ATCTAGACCTCTGTACAATTTTATCTAGGTCTANAATGTTTTGGGCATCTGANACTTAACTGCTGAATAAAATCACCTTT
TTTTTTTTTTTTT
Sequence Type genomic DNA
Unitrap ID UNI1559

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 121815161..121815252 88
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000078564 (BX000432.7) Novel zinc finger protein Fragment [Source:UniProtKB/TrEMBL;Acc:B1AZK8]


Sequence tag IST11504C7HMF1
Sequence
ATCTAGACCTCTGTACAATTTTATCTAGGTCTAGAATGTTTTGGGCATCTGANACTTAACTGCTGAATAAAATCACCTTT
TTTTTTTTTTTTT
Sequence Type genomic DNA
Unitrap ID UNI1559

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 121815161..121815252 90
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000078564 (BX000432.7) Novel zinc finger protein Fragment [Source:UniProtKB/TrEMBL;Acc:B1AZK8]

 
Come back to gene ENSMUSG00000078564


For any suggestions or comments, please send an email to unitrap@crg.es