Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12071G11
Clone ID IST12071G11
Vector VICTR76
Project tigm

Sequence tag IST12071G11HMF2
Sequence
TGGCTGACCTGGAACTCACTGTGTAGACCAGGCTG
Sequence Type genomic DNA
Unitrap ID UNI16353 UNI32149

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 24258882..24258916 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 21335486..21335520 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 9655688..9655722 35
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000072663 (Spef2) NM_177123 sperm flagellar 2 Gene [Source:MGI Symbol;Acc:MGI:2443727]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 72116918..72116952 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 134466568..134466602 35
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028822 (Tmem50a) NM_027935 transmembrane protein 50A Gene [Source:MGI (curated);Acc:Tmem50a-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 48311906..48311940 35
NO GENE  


Sequence tag IST12071G11BBF1
Sequence
CCAGGATCTCCCCTAACACCCTGTCACATAGCGAGGCTTTTCCTTCTCTCTTACCCTTTTGGAACCAAGTGTTGAAGGGG
TGAGATGCCTGGGAAACCCGGACCATCCCTGAGTCCTCAGAATGAAGAATCAGAAGGGCTAAGGGTTCCTGGAAGGACAG
GAGTGCAGAGTANCGCATATGCAACTTTTAATTGCTTCTTTCTCCCTCCCCAGTGCGTGTAGGTTTAGAAGCCCAGATTT
CTTGCTCAGGGAAGGAGTTATGTGGGAGTCTTCTTTTTGGGCAAGGGGACGAGATGGACTTGACCGTGTTGGCAGGTTTT
GGTTCTTCTTTCCGGTGCCTGAAATGTAGCAGTTTGNGGATCT
Sequence Type genomic DNA
Unitrap ID UNI29489

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 165704309..165704670 358
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039671 (Prkcbp1) NP_081506 protein kinase C binding protein 1 Gene [Source:MGI (curated);Acc:Prkcbp1-010]

 
Come back to gene ENSMUSG00000039671


For any suggestions or comments, please send an email to unitrap@crg.es