Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14307B10
Clone ID IST14307B10
Vector VICTR74
Project tigm

Sequence tag IST14307B10HMR1
Sequence
TTGCTGGGATTTGAACTCAGGACCTCTGGAAGAGCAGTCC
Sequence Type genomic DNA
Unitrap ID UNI7391 UNI33960 UNI33961

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 74756325..74756364 40
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 35916677..35916716 40
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 3054507..3054546 40
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 135011556..135011595 40
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028803 (Npal3) NM_028995 NIPA-like domain containing 3 Gene [Source:MGI (curated);Acc:Npal3-002]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 132128033..132128072 40
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029673 (Auts2) NP_796021 autism susceptibility candidate 2 Gene [Source:MGI Symbol;Acc:MGI:1919847]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 17496425..17496464 40
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 106672025..106672064 40
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040661 (Rad54l2) NM_030730 Rad54 like 2 (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1933196]

 
Come back to gene ENSMUSG00000040661


For any suggestions or comments, please send an email to unitrap@crg.es