Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10548B3
Clone ID IST10548B3
Vector VICTR76
Project tigm

Sequence tag IST10548B3HMR1
Sequence
AGCACATGAGGTNNGTCACTCTAGTCAGGAAAAACTGCACGAGGACATATGGTCAAAGATCTCAGACAGACACACACAGA
GATCCGAAGTCCTTCACAGTCCACCATCTGGCTTGTCAGCTCTTGATGAACTGTCTGTCCTTCCCTCTGCCCAGCTTCTA
CAGCAGACCACAGGCCTCAGCCAGGACCCTAGAGAGTCCACCGCACGAAATGCCCCATCTCAAAGATGCTGAATCTTGAG
TTCTGGCTTCTGTATAGTCAGCAAGTCANCGTCTACTAAGGATCCTATTAGTACATACAGTTCTGCAGGGCCAAGTCCAG
GGCATGCAAAGATGCTATGCCCTGTTCNCAGCCCTCANTAAATGCTGCTGGTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 55007394..55007766 363
 
EST/CDNA Est Name
  AA030193.1 - AI322540.1 - AI789455.1


Sequence tag IST10548B3BBF1
Sequence
TGCTTATGGCTAATGAGGCGGAACAGCTGGGCCTCCAGCTGACTTTTGCCCCTTGAATTTCTTCTTGGAAGCTAGTTAGT
TTCCTATCTTGGAGAGGTTTTCCAAGGATCT
Sequence Type genomic DNA
Unitrap ID UNI13165

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 55007288..55007397 110
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000000958 (Slc7a7) NM_011405 solute carrier family 7 (cationic amino acid transporter, y+ system), member 7 Gene [Source:MGI Symbol;Acc:MGI:1337120]


Sequence tag IST10548B3HMF1
Sequence
TGCTTATGGCTAATGAGGCGGAACAGCTGGGCCTCCAGCTGACTTTTGCCCCTTGAATTTCTTCTTGGAAGCTAGTTAGT
TTCCTATCTTGGAGAGGTTTTCCAAGGATCCATCCATCTTAAGTTTGAGTTAGGTCATGTCCCACAGTCACCTTAGCAAT
TAGGGTGGCATCANAATTTAGGGTTATTCCTAGTATAGGATCANTGCAAATTCCTCTCCAGAAGTGAAGGGGCACAGCTG
TGTGAGGGTTTAACCCATATAGCTCTTANGGGTTCATTCTTGGGCCCTTTTCTCTGTTACCTTTGTCTCCACTTCAAAAG
TACCGAAGGGATGTTCTAGANGAATGCTGGGAGAATTGCCTGGAACAGTGGGTCTGAATCTNANCTGTNCACTGNNNTTA
TNAAGAGAATTTTAAAAATATAGATTTATTTATGTGCNTGGGTATTTTGCCTGCATTCATGTCTGTNCAGTATGTTCATG
CCCAGTGCCCATGGNNGCTGAAAGAAGGTGCTGGGCCCCTGGAACTGATGGCTGTNANCCACCCTGTGGGTGCTGGNNAT
N
Sequence Type genomic DNA
Unitrap ID UNI13165

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 55006842..55007397 520
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000000958 (Slc7a7) NM_011405 solute carrier family 7 (cationic amino acid transporter, y+ system), member 7 Gene [Source:MGI Symbol;Acc:MGI:1337120]

 
Come back to gene ENSMUSG00000000958


For any suggestions or comments, please send an email to unitrap@crg.es