Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12544G6
Clone ID IST12544G6
Vector VICTR76
Project tigm

Sequence tag IST12544G6HMF1
Sequence
ATATGTCCCTACTGCTGCCAAGACACACAGGTGACTCAAGGTCANAATCTGGCCCAGAGGCCAGCCATTGTTCTGTGCAC
ATTCCGGTTCTAAATCAATGTCCAGTCCTGCTTGAATTGGGTCAAGGTATGGCAGGCAAGATGACCATTGTCCTCTGCCC
TGANATGATTTGAGGCTGTAAATTAAATGTCACACTTTCTCTGTTAGCTATTGGATTCTCTTCANATCTCTAAAGGAGCC
GAGGCAAATGTTGCTTANATTCCTTTCCCATCCTTTCTGTGTGTGGACATTGTGCCTCCTANTTTCACTTTCTGGGAACT
TTGCCAGCTTTCCAAGGACTGAGTAGTGAACAAAATAAATATTTGTANGTANTTTAAAAGGAGAACNNNTCTGTCN
Sequence Type genomic DNA
Unitrap ID UNI32282

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 20440130..20440524 373
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036617 (Etl4) NM_001081006 enhancer trap locus 4 Gene [Source:MGI (curated);Acc:Etl4-007]


Sequence tag IST12544G6BBF1
Sequence
ATATGTCCCTACTGCTGCCAAGACACACANGNGACTCAAGGTCAGAATCTGGCCCAGAGGCCAGCCATTGTTCTGTGCAC
ATTCCGGTTCTAAATCAATGTCCAGTCCTGCTTGAATTGGGTCAAGGTATGGCAGGCAAGATGACCATTGTCCTCTGCCC
TGAGATGATTTGAGGCTGTAGATTAAATGTCACACTTTCTCTGTTANCTATTGGATTCTCTTCAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI32282

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 20440130..20440358 223
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036617 (Etl4) NM_001081006 enhancer trap locus 4 Gene [Source:MGI (curated);Acc:Etl4-007]

 
Come back to gene ENSMUSG00000036617


For any suggestions or comments, please send an email to unitrap@crg.es