Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11905D2
Clone ID IST11905D2
Vector VICTR76
Project tigm

Sequence tag IST11905D2HMF1
Sequence
AGGGCAGCAGCAGCTGACCGTGCAGAACGTTTCTGGAAACAACCTGACTATCANTGGGCTGAGCCCCACCCANATCCAGC
TGCAGATGGAGCAGGCTCTAGCCGGANAGGCCCAGCCTGGGGAGAAACGGCGGCGCATGGCCTGCACGTGTCCCAACTGC
AAGGATGGGGAGAAGAGGTAATATGCCCGACCCTGGA
Sequence Type genomic DNA
Unitrap ID UNI22063

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 96817400..96817595 190
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018678 (Sp2) NM_030220 Sp2 transcription factor Gene [Source:MGI (curated);Acc:Sp2-001]

 
Come back to gene ENSMUSG00000018678


For any suggestions or comments, please send an email to unitrap@crg.es