Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12123D9
Clone ID IST12123D9
Vector VICTR76
Project tigm

Sequence tag IST12123D9HMF1
Sequence
ACCCTGTCCTAGCATCTCTGATATCACCCAAAACCATGGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 71026440..71026478 39
NO GENE  


Sequence tag IST12123D9HMR1
Sequence
GGTNAGCTTTGGAAAATGGTCAGTGGGAGAATAGGCCTAGGT
Sequence Type genomic DNA
Unitrap ID UNI11419

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 71026401..71026442 40
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022099 (Epb4.9) NM_013514 erythrocyte protein band 4.9 Gene [Source:MGI Symbol;Acc:MGI:99670]


Sequence tag IST12123D9BBF1
Sequence
ACCCTGTCCTAGCATCTCTGATATCACCCAAAACCATGGCCAGATCCAGAGGTACAGCCCAAAATACCTACGTAAAGAAA
GAGAGGCAAAAGACCCTGTCACCTACCTCCTCCCAGACAGTGGGGCCCAGGCTCTCTGAAGCCCCAGGAAGCAAAAGGCT
AGGCCCTGGTCGACTGGGTGGCCGCGTTTTCTCAGGAATCTAGGTAAGAGGCANCTTCTCCAGGAACCCAGCCGCGCTTT
ACNAAGCACAAATAACAGGAAGAAAGCCGGCTTAGGGTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 71026440..71026717 274
 
EST/CDNA Est Name
  NM_013514.2 - BC016897.1 - AK165204.1

 
Come back to gene NM_013514.2 - BC016897.1 - AK165204.1


For any suggestions or comments, please send an email to unitrap@crg.es