Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12295D7
Clone ID IST12295D7
Vector VICTR76
Project tigm

Sequence tag IST12295D7BBF1
Sequence
TTTTCACTACATGGCTACTATAATAGTTAACAGAGGGGAAAACAACAAGACATAGGGGAATCTGAAAATAATGTAATTAT
TTTATATAAGAAACTGATTTTTCTTTACTATAGGAAGAATACTCATTAATTTGTTGTATTAATTTATTATAATCTTAATA
CAAAAATGTAATGAGAAAGATAATTTAATGAGAGGCAAGGATACGTTAAGTCCATCCTCAATCTTGTATATAAGTACAAT
TTTTGTTTGTTTTTGTTTTTTAAGATAGGGTTTCTCTTTGTAGCAGCCCTGACTCTCCTAGAATTAGCTCTGTAGTCCAG
GCTGACCAGGCTGGCCTCAAACTTNNANANATCN
Sequence Type genomic DNA
Unitrap ID UNI2811

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 21747232..21747583 344
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000047368 (5730446C15Rik) NM_146096 family with sequence similarity 108, member B Gene [Source:MGI Symbol;Acc:MGI:1917816]

 
Come back to gene ENSMUSG00000047368


For any suggestions or comments, please send an email to unitrap@crg.es