Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12291D12
Clone ID IST12291D12
Vector VICTR76
Project tigm

Sequence tag IST12291D12HMF2
Sequence
TAAGATTCCTCCGTTTACCTTTCGCCATCTGGTAATCTCTGGAGTTAGTAGTTATAGTTAACG
Sequence Type genomic DNA
Unitrap ID UNI15225 UNI15232 UNI29644 UNI30806 UNI30807 UNI30808 UNI30809 UNI30811

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 11616163..11616224 60
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000057715 (A830018L16Rik) NM_177173 RIKEN cDNA A830018L16 gene Gene [Source:MGI Symbol;Acc:MGI:2444149]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 5255550..5255611 60
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019769 (Syne1) NM_022027 synaptic nuclear envelope 1 Gene [Source:MGI Symbol;Acc:MGI:1927152]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 7826410..7826471 60
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 9689631..9689692 60
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 4074103..4074164 60
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033715 (Akr1c14) NM_134072 aldo-keto reductase family 1, member C14 Gene [Source:MGI (curated);Acc:Akr1c14-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 3176686..3176747 60
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 4369590..4369651 60
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000049148 (Plcxd3) NM_177355 phosphatidylinositol-specific phospholipase C, X domain containing 3 Gene [Source:MGI (curated);Acc:Plcxd3-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 14814938..14814999 60
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 11692063..11692124 60
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023826 (Park2) NP_057903 Parkinson disease (autosomal recessive, juvenile) 2, parkin Gene [Source:MGI Symbol;Acc:MGI:1355296]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 10881117..10881178 60
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 20647503..20647564 60
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 7843104..7843165 60
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 4169870..4169931 60
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 5641479..5641540 60
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000049119 (1700012H17Rik) NM_173426 family with sequence similarity 110, member B Gene [Source:MGI Symbol;Acc:MGI:1916593]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 3987209..3987270 60
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040407 (Akap9) NM_194462 A kinase (PRKA) anchor protein (yotiao) 9 Gene [Source:MGI (curated);Acc:Akap9-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 6938945..6939006 60
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042505 (Acn9) NM_001077713 ACN9 homolog (S. cerevisiae) Gene [Source:MGI (curated);Acc:Acn9-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 5110407..5110468 60
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 3912818..3912879 60
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 4771114..4771175 60
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166307: 48334..48395 60
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166309: 114805..114866 60
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166335: 5716..5777 60
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166438: 134244..134305 60
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 4906309..4906370 60
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr Y: 2531229..2531290 60
NO GENE  


Sequence tag IST12291D12BBF1
Sequence
TAAGATTCCTCCGTTTACCTTTCGCCATCTGGTAATCTCTGGAGTTAGTAGTTATAGTTGACTCTGTTTAGAGATTGTTC
TTCTGGTGATTCTGTTACCGTCTATCAGCAGACCTGGGAGACAGATTCTCTCCTCTGAGTTTCAGTGCTCAGAGCACTCT
CTGCTGGCAAGCTCTCTTACAGGGAAGGTGCGCAGATATCTTGTATTTGGACCTCCTCCTGGCCGAAGAAGAAGGCCCAA
AACAGGACCTTTCTCAGACACTGTGTTGCTTTGGCAGTTCCCAGGTGGTACAGACTCTCACCTAAGCAGACTAAATTCCT
AAGTTCCTTGGAGTCCCGGGACCNAGATGGCGACCGCTGCTGCTGTGGCTNAGTCCGCCTCCCCTGCCGGGTGGGCACCT
GTCCTCCGGTCCGGAANGTGGCCGGCTGTCCCCGGCCCACACAGGGTGCTGCCTCAGCGCCTCTGTGCTTCTGCCTGTTC
CAGANNCTGTCANGNTCTCTGGCNCACCCTCTNACCNNTTNNNACN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 65569801..65570316 498
 
EST/CDNA Est Name
  BF165206.1

 
Come back to gene BF165206.1


For any suggestions or comments, please send an email to unitrap@crg.es