Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14410F1
Clone ID IST14410F1
Vector VICTR74
Project tigm

Sequence tag IST14410F1BBF1
Sequence
ATGTTAAAAGATAATAAGTTGAAGAGGACTCAGAGGGTAAGAACCTTTGCTGCTCTTGCAGACAGGGCCCCAGTTTGATT
CCTAGTTCCCACACAGTAGTGCACAATCAGGAGCTGACACCCTCTCCGACCTCTGTGGTCACCAGACATGCAGGGGATAC
ACATACACACCTGCAAGCAACATACTCATACCCATTAAAAAGTAAAAACATAGCCGGGCCGGGTGTTGGTGGCGCATGCC
TTTAATCCCAGCACTCAGGAGGCAGAGGCAGGTGGATTTCTGAGTTTGAGGCCAGCCTGGTCTACAGAGTGAGTACCAGG
ACAGCCAGGGCTACACAGAGAAATCCTGTCTCGAAAAACCAAAAAACAAACAAACAAAAAACAAAAAAACATAGCCAGGC
GCGGTGGCGCACGTCTTTAATCCCAGCACTGGGGANGCAGAAGCAGTCNGATTTCTGAGTTCAAGGCNNGCCTGGTCTAC
AAAGTGAGTTCCAGGACAGCCNGGGCTATACAGANAAACCCTGTCTAGAAAAA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 106579959..106580490 520
 
EST/CDNA Est Name
  BY726363.1 - CF165785.1 - CF164416.1 - CN680180.1 - BB630762.1


Sequence tag IST14410F1HMR1
Sequence
NATGTANNNNNGCNNGNNNANNNNNNNNNGGTGNNNNNGNGNGATTTAATCTCAGCACTCCTGACAACAAACTGGGCGGT
GTGGGACACATCTTCAATCCCAGCACTGTAGGCAGAGGTAGGCAGAGGATCTATGAATTTGAGGCCAGCCAAGTCTACAG
AGTGAGTTCCAGGACAGCTAGAGCTACTCANANAAACCCTGTCTAAAACAAAACAAAACAAAAACAAANNACTGGGGCTG
GAGAGGTGACTCAGACTCTTGACTGTTCTTCCAGAGGTCCTGAGTTCAATTCCCAGTAACCACATGGTGGCTCACAACCA
TCTGAAATGGGATCTGATGCCCTCTTCNANATANAGTGTCTGAAGAGAGCGACAGTATACTCNTATACNTAAAATNAATA
AATCTTAAAAACNAAACAANCAAAATGAAAA
Sequence Type genomic DNA
Unitrap ID UNI14271

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 106579532..106579918 362
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020717 (Pecam1) NM_008816 platelet/endothelial cell adhesion molecule 1 Gene [Source:MGI (curated);Acc:Pecam1-002]


Sequence tag IST14410F1HMF1
Sequence
ATGTTAAAAGATAATAAGTTGAAGAGGACTCAGAGGGTAAGAACCTTTGCTGCTCTTGCAGACAGGGCCCCAGTTTGATT
CCTAGTTCCCACACAGTAGTGCACAATCAGGAGCTGACACCCTCTCCGACCTCTGTGGTCACCAGACATGCAGGGGATAC
ACATACACACCTGCAAGCAACATACTCATACCCATTAAAAAGTAAAAACATAGCCGGGCCGGGTGTTGGTGGCGCATGCC
TTTAATCCNNNCNCTCAGGAGGCAGAGGCAGGTGGATTTCTGAGTTTGAGGCCAGCCTGGTCTACAGAGTGAGTACCAGG
ACAGCCAGGGCTACACAGANAAATCCTGTCTCGAAAAACCAAAAAACAAACAAACNAAAAACAAANNANCATANCCNGGC
GCGGTGGCGCACGTCTTTAATCCCNNCACTGGGGAGGCANANNCNGTCGGANTTCTGANTTCNNGGCCANCCNGNTCTAC
NAANTGAGTTCCANGG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000020717


For any suggestions or comments, please send an email to unitrap@crg.es