Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_165A9-3
Clone ID CMHD-GT_165A9-3
Vector Gep-SD5
Project cmhd

Sequence tag CMHD-GT_165A9-3
Sequence
TCTTCGGTTTGCTGATGAAACAGCCATGCTAGAAAAACTGAAAGTTGGTCAAGGCTGTGCCACACCTTTGTCACTCTTCT
GCGATGATGGAGATGTTAAATTTGTCTTGGATTCAGCTTTTCTGGAAGGTGGACATGAGAAAGTGTACTTTCACCCAATG
ACTAATGCTGCAACAATGGGGTTAAGTCCTGAAGACTTTCTCATATTTGTGAAGGCTACAGGACATGATCCCATAATTCT
AAACTTTGATTAAAAAATGATTGGGAGGGCTGGAGAGATGGCTCAGCGGTTAAGAGCACTGACTGCACTTGCAGAGATCC
TGAGTTCAATTCCCAGCAACCACATGGTGGCTCACAACCATCTGTAACGGATCTGATGCCCTCTTCTGGTGTGTCTGAAG
ATAGCTACAGTATACTCCTATACATTAAATAA
Sequence Type mRNA
Unitrap ID UNI13965

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 29413072..29413503 430
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032673 (2010316F05Rik) NM_026465 non-protein coding RNA 117 Gene [Source:MGI Symbol;Acc:MGI:1915189]

 
Come back to gene ENSMUSG00000032673


For any suggestions or comments, please send an email to unitrap@crg.es