Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XR0900
Clone ID XR0900
Vector pGT0lxf
Project sanger

Sequence tag XR0900
Sequence
CAGATCCGAAGTATAGGCGGTATCGGATCGTCATGTGGGGAGGTATATTTTATGAAGGGACAACGAGTGGGGGGGGCCTG
GTGGAGAGCCCAAGTAGTGGCTTCCTATGAGGAGACCAATGAGGTGGAGATTCGCTACGTGGACTATGGTGGATATAAGA
GGGTGAAAGTCGACGTGCTCCGGCAAATTAGGTCTGACTTTGTGACCCTGCCATTCCAAGGAGCAGAAGTCCTTCTGGAC
AGCGTGGTTCCTCTGTCAGATGATGATCATTTTTCACCGGAGGCAGACGCAGCCATGAGTGAGATGACAGGCAATACAGC
ACTGTTGGCCCAG
Sequence Type mRNA
Unitrap ID UNI2197

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 88694456..88696512 117
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018428 (Akap1) NM_009648 A kinase (PRKA) anchor protein 1 Gene [Source:MGI (curated);Acc:Akap1-002]

 
Come back to gene ENSMUSG00000018428


For any suggestions or comments, please send an email to unitrap@crg.es