Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13553A11
Clone ID IST13553A11
Vector VICTR74
Project tigm

Sequence tag IST13553A11BBF1
Sequence
ACGGTAATTAGCAGTTAACAGGAGGAGGGGGCTAGAAGGTTCCACTTAGGTGTAAGCCGCACAGAANAAGCTATGCAGAT
CTGTC
Sequence Type genomic DNA
Unitrap ID UNI31678

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 32744062..32744145 80
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035656 (AC139244.4) Mucin Fragment [Source:UniProtKB/TrEMBL;Acc:Q9ERM1]


Sequence tag IST13553A11HMF1
Sequence
ACGGTAATTAGCAGTTAACAGGAGGAGGGGGCNANAAGGTTCCACTTANGTGTAAGCTGCACAGAAAAANCTATGCANAT
CTGTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000035656


For any suggestions or comments, please send an email to unitrap@crg.es