Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11528G7
Clone ID IST11528G7
Vector VICTR76
Project tigm

Sequence tag IST11528G7HMR1
Sequence
ATTGGTGCCAATCTATCTTGGGTGAGCACCTGCTC
Sequence Type genomic DNA
Unitrap ID UNI14434

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 92042505..92042539 35
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000058318 (Phf21a) NM_138755 PHD finger protein 21A Gene [Source:MGI (curated);Acc:Phf21a-002]


Sequence tag IST11528G7HMF1
Sequence
AAATGAAACTNACTTNNNAAATATCCCAATTTTCACTCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000058318


For any suggestions or comments, please send an email to unitrap@crg.es